Resources & Tools

Home › Resources & Tools › FASTQ Editor

FASTQ Editor

A simple online editor for biological sequences in the FASTQ format.

untitled.fastq — FASTQ Editor

@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC651
@SEQ_ID
2
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
3
+
4
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65

FASTQ Editor

Recommended for you

Product

Ea.

Leskoff Green Fluorescent Protein Poster

Green Fluorescent Protein Poster, Shaded View, English-Labeled

A poster featuring the green fluorescent protein structure.

Leskoff Human Karyotype Poster

Human Karyotype Poster, English-Labeled

A poster featuring the human karyotype.

Leskoff fonetika IPA Transcription Poster

fonetika IPA Transcription Poster

A poster featuring the phonetic transcription of "fonetika" in the International Phonetic Alphabet (IPA).

Leskoff Ligatures Poster

Ligatures Poster, English-Labeled

A poster showcasing stylistic Latin-script ligatures.

Leskoff Cook Islands Māori Alphabet Chart

Cook Islands Māori Alphabet Chart, 8.3 x 11.7 in (21.0 x 29.7 cm, Desk Chart, Laminated), English-Labeled

The Cook Islands Māori alphabet chart.

See also

Convert FASTQ files to FASTA format.

Bioinformatics Crossword

A daily crossword puzzle for bioinformatics terms.

Awesome bioinformatics

A curated list of awesome resources on bioinformatics.

Plasmid Map Generator

A tool to generate plasmid maps from GenBank files.

Scalable genomic alignment with Progressive Cactus

How progressive alignment makes it possible to efficiently align hundreds to thousands of large genomes.