Resources & Tools

Home › Resources & Tools › FASTQ Editor

FASTQ Editor

A simple online editor for biological sequences in the FASTQ format.

untitled.fastq — FASTQ Editor

@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC651
@SEQ_ID
2
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
3
+
4
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65

FASTQ Editor

Recommended for you

Product

Ea.

Leskoff Green Fluorescent Protein Poster

Green Fluorescent Protein Poster, Technical Illustration, Japanese-Labeled

A poster featuring the green fluorescent protein structure.

Leskoff Human Karyotype Poster

Human Karyotype Poster, Danish-Labeled

A poster featuring the human karyotype.

Leskoff 2026 Wall Calendar

2026 Wall Calendar, Corsican/English-Labeled, Sunday-Start Layout, Wire-Bound, 11 x 8.5 in (27.9 x 21.6 cm)

A Corsican-language wall calendar (2026, Sunday-start format) with English translations.

Leskoff Mandaic Alphabet Chart

Mandaic Alphabet Chart, 23.4 x 33.1 in (59.4 x 84.1 cm, Poster / Wall Chart), Korean-Labeled

The Mandaic alphabet chart with Korean metatext.

Leskoff Menthol Molecule Poster

Menthol Molecule Poster, Ball-and-Stick Model, Stylized, Japanese-Labeled

A poster featuring the ball-and-stick model (stylized) of the menthol molecule.

See also

Convert FASTQ files to FASTA format.

Plasmid Map Generator

A tool to generate plasmid maps from GenBank files.

Bioinformatics pronunciation guide

A pronunciation guide for bioinformatics terms.

WikiPathways: A Wikipedia for biological pathways

An overview of the collaboratively edited structured pathway encyclopedia.

Scalable genomic alignment with Progressive Cactus

How progressive alignment makes it possible to efficiently align hundreds to thousands of large genomes.