Resources & Tools

Home › Resources & Tools › FASTQ Editor

FASTQ Editor

A simple online editor for biological sequences in the FASTQ format.

untitled.fastq — FASTQ Editor

@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC651
@SEQ_ID
2
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
3
+
4
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65

FASTQ Editor

Recommended for you

Product

Ea.

Leskoff Human Karyotype Poster

Human Karyotype Poster

A poster featuring the human karyotype.

Leskoff Hemoglobin Poster

Hemoglobin Poster, Shaded View

A poster featuring the hemoglobin structure.

Leskoff блокнот IPA Transcription Poster

блокнот IPA Transcription Poster

A poster featuring the phonetic transcription of "блокнот" in the International Phonetic Alphabet (IPA).

Leskoff 2026 Wall Calendar

2026 Wall Calendar, Romanian-Labeled, Sunday-Start Layout, Poster / Wall Print, 23.4 x 33.1 in (59.4 x 84.1 cm)

A Romanian-language wall calendar (2026, Sunday-start format).

Leskoff 2027 Wall Calendar

2027 Wall Calendar, Shan/English-Labeled, Sunday-Start Layout, Wire-Bound, 11.7 x 8.3 in (29.7 x 21.0 cm)

A Shan-language wall calendar (2027, Sunday-start format) with English translations.

See also

Convert FASTQ files to FASTA format.

Awesome bioinformatics

A curated list of awesome links, tutorials, and resources on bioinformatics and related topics.

WikiPathways: A Wikipedia for biological pathways

An overview of the collaboratively edited structured pathway encyclopedia.

Bioinformatics pronunciation guide

A pronunciation guide for bioinformatics terms.

Scalable genomic alignment with Progressive Cactus

How progressive alignment makes it possible to efficiently align hundreds to thousands of large genomes.