Home › Resources & tools › FASTQ Editor

FASTQ Editor

A simple online editor for biological sequences in the FASTQ format.

untitled.fastq — FASTQ Editor

@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC651
@SEQ_ID
2
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
3
+
4
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65

FASTQ Editor

Recommended for you

Product

Ea.

Leskoff Green Fluorescent Protein Poster

Green Fluorescent Protein Poster, Technical Illustration, English-Labeled

A poster featuring the green fluorescent protein structure.

Leskoff словоформа IPA Transcription Poster

словоформа IPA Transcription Poster

A poster featuring the phonetic transcription of "словоформа" in the International Phonetic Alphabet (IPA).

Leskoff Cube Poster

Cube Poster, Solid Shape, English-Labeled

A poster featuring a cube.

Leskoff Cubane Molecule Poster

Cubane Molecule Poster, Ball-and-Stick Model, Stylized, English-Labeled

A poster featuring the ball-and-stick model (stylized) of the cubane molecule.

Leskoff языкознание Morphemic Analysis Poster

языкознание Morphemic Analysis Poster

A poster featuring the morphemic analysis of the Russian word языкознание.

See also

Convert FASTQ files to FASTA format.

Scalable genomic alignment with Progressive Cactus

How progressive alignment makes it possible to efficiently align hundreds to thousands of large genomes.

Bioinformatics pronunciation guide

A pronunciation guide for bioinformatics terms.

Bioinformatics Crossword

A daily crossword puzzle for bioinformatics terms.

WikiPathways: A Wikipedia for biological pathways

An overview of the collaboratively edited structured pathway encyclopedia.

© 2025 Leskoff

Terms of service Privacy policy

All prices listed are in United States Dollars (USD). Visual representations of products are intended for illustrative purposes. Actual products may exhibit variations in color, texture, or other characteristics inherent to the manufacturing process. The products' design and underlying technology are protected by applicable intellectual property laws. Unauthorized reproduction or distribution is prohibited.